Author / Distributor:
Fredrik Ronquist, School of Computational Science, Florida State University, ronquist@csit.fsu.edu
John P. Huelsenbeck, Section of Ecology, Behavior and Evolution, Division of Biological Sciences, University of California, San Diego, johnh@biomail.ucsd.edu
MrBayes is a program for the Bayesian estimation of phylogeny. Bayesian inference of phylogeny is based upon a quantity called the posterior probability distribution of trees, which is the probability of a tree conditioned on the observations. It uses Markov chain Monte Carlo (or CMC) to approximate the posterior probabilities of trees.
Where the "4" in parameter is the number of parallel processes. Users can set to 2 -8 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement.
Then follow the instruction on the screen.
Run a parallel version with medium size data on interactive node
When running MPI jobs on the rcluster interactive node
(inter1), please first create a file host.list.
Refer to Running an Interactive Jobfor details about host.list.
Then run the mpirun command with:
Where the "4" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.
q
To quit the program, type q and ENTER
Run the job in the queue, refer to MrBayes
Below is an example file defines the data. Save this file as e.x. yh.nex
#NEXUS
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTAT
Hylobates ATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
end;
Define all the parameters in the .par file, e.x.
yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.
mb
Then follow the instruction on the screen. To quit the program, type q and ENTER. Use quit to quit the program.
quit
Run a parallel version with large data
* for tcsh, csh shell users
source /usr/local/bin/use_mpich.csh
* for bash shell usersmpirun -np 4 /usr/local/mrbayes/mbp
. /usr/local/bin/use_mpich.sh
Where the "4" in parameter is the number of parallel processes. Users can set to 2 -8 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement.mpirun -np 4 /usr/local/mrbayes/mbp
Then follow the instruction on the screen.
q
To quit the program, type q and ENTER