UGA logo RCC: Research Computing Center
 
 
Home >
 
 
RESOURCES
SERVICES
Application & Code Development
Consulting
Grantwriting Support

MrBayes (Bayesian Analysis of Phylogeny)

Category | Version | Author | Description
Program on:altix | inQuiry | pcluster | rcluster,IOB

Category(ies): Bioinformatics

Version: 3.1.2

Author / Distributor:
Fredrik Ronquist, School of Computational Science, Florida State University, ronquist@csit.fsu.edu
John P. Huelsenbeck, Section of Ecology, Behavior and Evolution, Division of Biological Sciences, University of California, San Diego, johnh@biomail.ucsd.edu

Description:

MrBayes is a program for the Bayesian estimation of phylogeny. Bayesian inference of phylogeny is based upon a quantity called the posterior probability distribution of trees, which is the probability of a tree conditioned on the observations. It uses Markov chain Monte Carlo (or CMC) to approximate the posterior probabilities of trees.

altix: running program | Documentation | Installation | System

Running Program:

Run a serial version for small size data

mb

Then follow the instruction on the screen. To quit the program, type q and ENTER. Use quit to quit the program.

quit

Run a parallel version with large data

* for tcsh, csh shell users

source /usr/local/bin/use_mpich.csh
mpirun -np 4 /usr/local/mrbayes/mbp

* for bash shell users

. /usr/local/bin/use_mpich.sh
mpirun -np 4 /usr/local/mrbayes/mbp

Where the "4" in parameter is the number of parallel processes. Users can set to 2 -8 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement.
Then follow the instruction on the screen.

q

To quit the program, type q and ENTER

Documentation: http://mrbayes.csit.fsu.edu/wiki/index.php/Manual

Installation:

System(s): Unix

Back to top


inQuiry: not available at inQuiry

Back to top


pcluster: Not available on pcluster

Back to top


rcluster,IOB: running program | Documentation | Installation | System

Running Program: also refer to submit jobs to queues at rcluster,IOB

Run a parallel version with medium size data on interactive node
When running MPI jobs on the rcluster interactive node (inter1), please first create a file host.list.
Refer to Running an Interactive Jobfor details about host.list.
Then run the mpirun command with:

ssh inter1
mpirun -np 4 -machinefile host.list /usr/local/mrbayes/mb

Where the "4" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.

q

To quit the program, type q and ENTER

Run the job in the queue, refer to MrBayes
Below is an example file defines the data. Save this file as e.x. yh.nex

#NEXUS
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTAT
Hylobates ATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
end;

Define all the parameters in the .par file, e.x. yh.par. Notice the yh.nex is a data file defined above. This example performs three single-run analyses of the data yh.nex.

set autoclose=yes nowarn=yes;
execute yh.nex;
lset nst=6 rates=gamma;
mcmc nruns=1 ngen=10000 samplefreq=10 file=yh.nex1;
mcmc file=yh.nex2;
mcmc file=yh.nex3;

Below is a script subp.sh to the batch queue, yh.par is the file definced above

#!/bin/bash
cd /home/rccstaff/yhuang/iobdemo/mrbayesTest
echo $LSB_HOSTS
cat /dev/null > mlist.$$
for variable in $LSB_HOSTS; do
echo $variable >> mlist.$$
done
mpirun -np 4 -machinefile mlist.$$ /usr/local/mrbayes/mb < yh.par > myout
rm -f mlist.$$

After saved the subp.sh, use following add excute permission to the subp.sh

chmod u+x subp.sh

Then submit all these to the queue as

bsub -n 4 -q r4-24h -o mbtest.out.%J -e mbtest.err.%J ./subp.sh

Documentation: Same as altix

Installation: Same as altix

System(s): Unix

Back to top


 
Partnering with UGA